ID: 1022232116_1022232119

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1022232116 1022232119
Species Human (GRCh38) Human (GRCh38)
Location 7:28424066-28424088 7:28424079-28424101
Sequence CCCTCCTTCTTCTGTCTTCTCTG GTCTTCTCTGTGACTTCACATGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 13, 3: 98, 4: 553}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!