ID: 1022342294_1022342301

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1022342294 1022342301
Species Human (GRCh38) Human (GRCh38)
Location 7:29479940-29479962 7:29479975-29479997
Sequence CCCTCCATCACTCAAACTGGGCC TGCCGGAGGCTGCTGCAGACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 128} {0: 1, 1: 0, 2: 1, 3: 17, 4: 195}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!