ID: 1022407839_1022407844

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1022407839 1022407844
Species Human (GRCh38) Human (GRCh38)
Location 7:30108787-30108809 7:30108800-30108822
Sequence CCAGTAGCTCCCTTCCTTTGTTC TCCTTTGTTCCTTTGGCAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 320} {0: 1, 1: 0, 2: 1, 3: 24, 4: 286}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!