ID: 1022410325_1022410344

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1022410325 1022410344
Species Human (GRCh38) Human (GRCh38)
Location 7:30134975-30134997 7:30135026-30135048
Sequence CCGCCCGCCCCACTCCGCACCGC GGCCCCGGAGGAGCCCGCGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 105, 4: 924} {0: 1, 1: 0, 2: 9, 3: 41, 4: 316}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!