ID: 1022496317_1022496322

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1022496317 1022496322
Species Human (GRCh38) Human (GRCh38)
Location 7:30855168-30855190 7:30855210-30855232
Sequence CCTTGGGAAAGTCACTGGGTCTC TGGAAGATGGAGCAGTTATCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 137, 4: 734} {0: 1, 1: 0, 2: 0, 3: 17, 4: 170}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!