ID: 1022624644_1022624657

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1022624644 1022624657
Species Human (GRCh38) Human (GRCh38)
Location 7:32022479-32022501 7:32022532-32022554
Sequence CCAAGGAGAAGTCATGAATGTGG TTTAAGGGGAGCACAGAAGGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 21, 4: 229}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!