ID: 1022627812_1022627818

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1022627812 1022627818
Species Human (GRCh38) Human (GRCh38)
Location 7:32056116-32056138 7:32056163-32056185
Sequence CCAAGCTGATGTAGAAAGTAGAG GGGACCTGGCAAATTTGGCAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 11, 4: 123}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!