ID: 1022644235_1022644242

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1022644235 1022644242
Species Human (GRCh38) Human (GRCh38)
Location 7:32215887-32215909 7:32215926-32215948
Sequence CCTGCAAGGAAATCTGCCCAGTG CTTTGCCACAGCCCTGGGTCTGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 0, 3: 22, 4: 293}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!