|
Left Crispr |
Right Crispr |
Crispr ID |
1022676128 |
1022676132 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
7:32500871-32500893
|
7:32500903-32500925
|
Sequence |
CCCCATTGCTTATTTTGTCAGGT |
AGCAGATGGCTGTAGATGTGTGG |
Strand |
- |
+ |
Off-target summary |
{0: 7, 1: 67, 2: 127, 3: 143, 4: 285} |
{0: 3, 1: 249, 2: 4815, 3: 5399, 4: 8876} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|