ID: 1022676128_1022676132

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1022676128 1022676132
Species Human (GRCh38) Human (GRCh38)
Location 7:32500871-32500893 7:32500903-32500925
Sequence CCCCATTGCTTATTTTGTCAGGT AGCAGATGGCTGTAGATGTGTGG
Strand - +
Off-target summary {0: 7, 1: 67, 2: 127, 3: 143, 4: 285} {0: 3, 1: 249, 2: 4815, 3: 5399, 4: 8876}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!