ID: 1022694409_1022694424

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1022694409 1022694424
Species Human (GRCh38) Human (GRCh38)
Location 7:32690192-32690214 7:32690243-32690265
Sequence CCCCCACTTACGTCCTTTTCCCT CCCTCCTACTCACCTTCTTCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!