ID: 1022734387_1022734395

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1022734387 1022734395
Species Human (GRCh38) Human (GRCh38)
Location 7:33062627-33062649 7:33062640-33062662
Sequence CCAGCACCACCCCCGCCACCAGG CGCCACCAGGGCGCACACGCTGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 8, 3: 156, 4: 1043} {0: 3, 1: 0, 2: 0, 3: 13, 4: 81}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!