ID: 1022892967_1022892974

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1022892967 1022892974
Species Human (GRCh38) Human (GRCh38)
Location 7:34719945-34719967 7:34719979-34720001
Sequence CCCTCCATGCCCATGCCACACTT GAAAAAAAAAAAAGGAGCCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 287} {0: 1, 1: 10, 2: 121, 3: 1729, 4: 11185}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!