ID: 1022899929_1022899939

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1022899929 1022899939
Species Human (GRCh38) Human (GRCh38)
Location 7:34797378-34797400 7:34797412-34797434
Sequence CCACTCTTGCATGGAAGCGTGAT CTCTGTGTATGGGGGACAGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 55} {0: 1, 1: 0, 2: 3, 3: 36, 4: 308}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!