ID: 1022907557_1022907564

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1022907557 1022907564
Species Human (GRCh38) Human (GRCh38)
Location 7:34871568-34871590 7:34871618-34871640
Sequence CCTTCCACCATCAGCCTGTAAAA TACAATGGTGGCACAAGCATTGG
Strand - +
Off-target summary No data {0: 1, 1: 21, 2: 169, 3: 1088, 4: 2198}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!