ID: 1023013554_1023013559

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1023013554 1023013559
Species Human (GRCh38) Human (GRCh38)
Location 7:35943927-35943949 7:35943943-35943965
Sequence CCCTTACTCATCAGCCAATGGTT AATGGTTCCGACTGGAGAGAGGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 1, 3: 7, 4: 102} {0: 2, 1: 1, 2: 0, 3: 7, 4: 135}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!