ID: 1023030247_1023030256

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1023030247 1023030256
Species Human (GRCh38) Human (GRCh38)
Location 7:36084755-36084777 7:36084804-36084826
Sequence CCATGAGCAAAACACTGAGCCCA ACCGCCATGCTAGATCTGTGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 289} {0: 1, 1: 0, 2: 0, 3: 0, 4: 46}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!