ID: 1023038829_1023038836

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1023038829 1023038836
Species Human (GRCh38) Human (GRCh38)
Location 7:36154759-36154781 7:36154808-36154830
Sequence CCAGCTCATGAGCGTGCGAGGCC GTGGACTTCCGCCGTGAGCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 38} {0: 1, 1: 0, 2: 0, 3: 1, 4: 42}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!