ID: 1023054767_1023054774

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1023054767 1023054774
Species Human (GRCh38) Human (GRCh38)
Location 7:36282795-36282817 7:36282819-36282841
Sequence CCATGTCTACCCAGTTGTTACCC GCAGTATTGTGGGCCCAATGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 7, 4: 93}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!