ID: 1023116566_1023116575

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1023116566 1023116575
Species Human (GRCh38) Human (GRCh38)
Location 7:36868642-36868664 7:36868682-36868704
Sequence CCTGCCCGCTTCTCCTTATTCTG CTCAAGCTCTTTATATGTTGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 22, 4: 240}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!