ID: 1023142557_1023142559

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1023142557 1023142559
Species Human (GRCh38) Human (GRCh38)
Location 7:37116815-37116837 7:37116829-37116851
Sequence CCTGGGTCATCCTAGAAAAGTAC GAAAAGTACTACATGTGCCTCGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 5, 3: 5, 4: 75} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!