ID: 1023200042_1023200044

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1023200042 1023200044
Species Human (GRCh38) Human (GRCh38)
Location 7:37687118-37687140 7:37687132-37687154
Sequence CCAATTGATGATGTCAGTCGGAG CAGTCGGAGCACTGTTTCCTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 9, 4: 88}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!