ID: 1023314398_1023314401

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1023314398 1023314401
Species Human (GRCh38) Human (GRCh38)
Location 7:38920457-38920479 7:38920472-38920494
Sequence CCTGTCATTCTGTGCAGATAAGT AGATAAGTGAAAAGAAGGATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 167} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!