ID: 1023367240_1023367243

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1023367240 1023367243
Species Human (GRCh38) Human (GRCh38)
Location 7:39475896-39475918 7:39475932-39475954
Sequence CCTGGGTCATCAGCTTTTCTTGA CCCAGAAAGTTCCTACTCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 199} {0: 1, 1: 0, 2: 5, 3: 70, 4: 282}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!