ID: 1023382710_1023382713

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1023382710 1023382713
Species Human (GRCh38) Human (GRCh38)
Location 7:39623985-39624007 7:39624000-39624022
Sequence CCGGCTGGAATCCGGGGCACCGC GGCACCGCGTTCGCCGCTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 81} {0: 1, 1: 0, 2: 0, 3: 0, 4: 28}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!