ID: 1023620432_1023620443

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1023620432 1023620443
Species Human (GRCh38) Human (GRCh38)
Location 7:42066416-42066438 7:42066451-42066473
Sequence CCTAAGTAACTAAAAAGTCCAGT AAAGATGGGGAAAGGTGGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 22, 4: 198} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!