ID: 1023770856_1023770857

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1023770856 1023770857
Species Human (GRCh38) Human (GRCh38)
Location 7:43555434-43555456 7:43555449-43555471
Sequence CCTGATCAGGAAGCACTGAAGAG CTGAAGAGACAGTTGTGCATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 161} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!