ID: 1023807729_1023807731

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1023807729 1023807731
Species Human (GRCh38) Human (GRCh38)
Location 7:43885788-43885810 7:43885805-43885827
Sequence CCATCTGCAATGTCCAAGCTGCA GCTGCAGCCACTCACCATGCAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 2, 3: 23, 4: 257}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!