ID: 1023816111_1023816115

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1023816111 1023816115
Species Human (GRCh38) Human (GRCh38)
Location 7:43951249-43951271 7:43951265-43951287
Sequence CCTAGGCCAGGCACAACCACATG CCACATGCACTGTAGCATGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 238} {0: 1, 1: 0, 2: 0, 3: 13, 4: 113}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!