ID: 1023850799_1023850804

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1023850799 1023850804
Species Human (GRCh38) Human (GRCh38)
Location 7:44149271-44149293 7:44149301-44149323
Sequence CCTCCGGAACTTCTGAGAAAGGT GGTGTGGAAGACCCCTCTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 86} {0: 1, 1: 0, 2: 4, 3: 13, 4: 122}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!