ID: 1023853335_1023853342

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1023853335 1023853342
Species Human (GRCh38) Human (GRCh38)
Location 7:44163050-44163072 7:44163098-44163120
Sequence CCTGTGCATTGCCTAGGGAGGGG GCTGAGAGGCAGGATAACACTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 12, 4: 180}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!