ID: 1023855066_1023855075

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1023855066 1023855075
Species Human (GRCh38) Human (GRCh38)
Location 7:44177922-44177944 7:44177965-44177987
Sequence CCAGGGGTGGTCCTAGAAATCAG GAGTTGGATCACTTCCCAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 159} {0: 1, 1: 0, 2: 6, 3: 11, 4: 105}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!