ID: 1023899878_1023899889

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1023899878 1023899889
Species Human (GRCh38) Human (GRCh38)
Location 7:44467487-44467509 7:44467536-44467558
Sequence CCAGGCTGCCAAGTTAGAACCCA AGGTGGAGCTCTTTGATCAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 138} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!