ID: 1023926789_1023926795

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1023926789 1023926795
Species Human (GRCh38) Human (GRCh38)
Location 7:44675321-44675343 7:44675336-44675358
Sequence CCCTGGCTCCACTTCTTTCTTAG TTTCTTAGAATGACTTACGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 308} {0: 1, 1: 0, 2: 6, 3: 146, 4: 1136}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!