ID: 1024062032_1024062035

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1024062032 1024062035
Species Human (GRCh38) Human (GRCh38)
Location 7:45704985-45705007 7:45705024-45705046
Sequence CCTTGCACTCTCCTTTTCCACAG TACAAATAATTATTCTGAATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 32, 4: 404} {0: 1, 1: 0, 2: 6, 3: 67, 4: 527}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!