ID: 1024075609_1024075619

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1024075609 1024075619
Species Human (GRCh38) Human (GRCh38)
Location 7:45816453-45816475 7:45816500-45816522
Sequence CCTGCTCATGCTGCCCCAGCAGC AGCCTCTGGGACCCATGCAGCGG
Strand - +
Off-target summary {0: 1, 1: 21, 2: 12, 3: 55, 4: 438} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!