ID: 1024231852_1024231858

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1024231852 1024231858
Species Human (GRCh38) Human (GRCh38)
Location 7:47368914-47368936 7:47368935-47368957
Sequence CCTGCATCTGGGCGGACACTGAG AGGGCTTTCTCAGCAGGGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 137} {0: 1, 1: 0, 2: 2, 3: 27, 4: 289}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!