ID: 1024242479_1024242484

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1024242479 1024242484
Species Human (GRCh38) Human (GRCh38)
Location 7:47446340-47446362 7:47446364-47446386
Sequence CCTGCTCACGTCCTCAGAAGCCT CCCAAGCTGTGGTTTCCTTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 159} {0: 1, 1: 0, 2: 4, 3: 18, 4: 204}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!