ID: 1024242788_1024242801

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1024242788 1024242801
Species Human (GRCh38) Human (GRCh38)
Location 7:47448278-47448300 7:47448328-47448350
Sequence CCCATTCCCTCTGCAACAAAACT GACATGGGATCCTCCCCAGGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 6, 4: 129}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!