ID: 1024251461_1024251462

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1024251461 1024251462
Species Human (GRCh38) Human (GRCh38)
Location 7:47508780-47508802 7:47508802-47508824
Sequence CCAGGATCACTCATTCTGAGGAC CAGCCAGATGCCATGTTGTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 124} {0: 1, 1: 2, 2: 43, 3: 147, 4: 442}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!