ID: 1024369222_1024369234

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1024369222 1024369234
Species Human (GRCh38) Human (GRCh38)
Location 7:48560323-48560345 7:48560370-48560392
Sequence CCCCCAGTCACTGTGCTCTTCCT CCACACCATACAGCTGCTGCAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 12, 3: 44, 4: 250}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!