ID: 1024537376_1024537380

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1024537376 1024537380
Species Human (GRCh38) Human (GRCh38)
Location 7:50449551-50449573 7:50449589-50449611
Sequence CCTACTCAGTACCAAGCACTGTG ATTCTGTTCTTGATGCAAAACGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 21, 3: 195, 4: 1240} {0: 1, 1: 0, 2: 2, 3: 29, 4: 249}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!