|
Left Crispr |
Right Crispr |
Crispr ID |
1024550456 |
1024550467 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
7:50558776-50558798
|
7:50558810-50558832
|
Sequence |
CCAGAGATGAGACCACAGGACTC |
CTCACTGGGGATGGGGAAGGTGG |
Strand |
- |
+ |
Off-target summary |
{0: 1, 1: 0, 2: 3, 3: 30, 4: 401} |
{0: 1, 1: 0, 2: 10, 3: 95, 4: 693} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|