ID: 1024559916_1024559925

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1024559916 1024559925
Species Human (GRCh38) Human (GRCh38)
Location 7:50634619-50634641 7:50634665-50634687
Sequence CCAGCCATCTGCTGCCTACAAGA CCTACAGACTCAAAGTAAATGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 8, 3: 63, 4: 265}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!