ID: 1024577344_1024577354

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1024577344 1024577354
Species Human (GRCh38) Human (GRCh38)
Location 7:50775371-50775393 7:50775421-50775443
Sequence CCAAGGACCTGGGCAGCCCTGCA CAGCTCTCACAGGTTGCAGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 13, 3: 123, 4: 664} {0: 1, 1: 0, 2: 3, 3: 20, 4: 234}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!