ID: 1024619700_1024619710

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1024619700 1024619710
Species Human (GRCh38) Human (GRCh38)
Location 7:51146958-51146980 7:51146973-51146995
Sequence CCCCACCTTGGGCATGGTGATGG GGTGATGGGGAGCCAGCAGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 159} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!