ID: 1024629965_1024629977

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1024629965 1024629977
Species Human (GRCh38) Human (GRCh38)
Location 7:51238811-51238833 7:51238860-51238882
Sequence CCCTGGCAACCCTGCCTCATCCC TTCCCGGGAGTCCCCGGTGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 404} {0: 1, 1: 0, 2: 1, 3: 3, 4: 92}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!