ID: 1024639402_1024639419

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1024639402 1024639419
Species Human (GRCh38) Human (GRCh38)
Location 7:51316972-51316994 7:51317024-51317046
Sequence CCCGCGGCGAGCGTCCGGGGAAG ACACCCGCGGGTGCGGCAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 40} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!