ID: 1024919417_1024919427

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1024919417 1024919427
Species Human (GRCh38) Human (GRCh38)
Location 7:54542356-54542378 7:54542379-54542401
Sequence CCCCGCTTGCCCACTCCCCACTT CCCGAGCCGGCTCCGTGTTTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 333} {0: 1, 1: 0, 2: 0, 3: 3, 4: 38}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!