ID: 1024966193_1024966197

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1024966193 1024966197
Species Human (GRCh38) Human (GRCh38)
Location 7:55023958-55023980 7:55023976-55023998
Sequence CCATTGGGCCCATAGGCACAAGC CAAGCTGGCCAGTTTGAATTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 8, 4: 124}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!