ID: 1024966344_1024966349

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1024966344 1024966349
Species Human (GRCh38) Human (GRCh38)
Location 7:55025387-55025409 7:55025402-55025424
Sequence CCCAGATTGACACCCAGGCTTCT AGGCTTCTCACTTGGAAGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 44, 4: 318} {0: 1, 1: 0, 2: 0, 3: 18, 4: 195}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!